View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14757_low_21 (Length: 290)
Name: NF14757_low_21
Description: NF14757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14757_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 11 - 275
Target Start/End: Original strand, 25347363 - 25347620
Alignment:
| Q |
11 |
aagaatatggaagaaatttcaaaaaagggtagggcaataatagcaaaataatttccttttattgaccatgtgaacaagtcagtttgactcttgtgttatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
25347363 |
aagaatatggaagaaatttcaaaaaagggta-----ataacagcaaaatgatttccttttattgaccatgtgaacaaatcagtttgactc--gtgttatt |
25347455 |
T |
 |
| Q |
111 |
ctggcagctattcagacgcaaaaagagttagctgagcagttgaaggacctcccnnnnnnnntggaggtaatatagttaatgataaacattaaataatcag |
210 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25347456 |
cttgcagctattcagacgcagaaagagttagctgagcagctgaaggacctcccaaaaaaaatggaggtaatatagttaatgataaacattaaataatcag |
25347555 |
T |
 |
| Q |
211 |
ctattgataacgcattgttcgtcttttaacttttttcttttgctcttctagtctttcaagaacca |
275 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25347556 |
ctattgctaacacattgttcgtcttttaacttttttcttttgctcttctagtctttcaagaacca |
25347620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University