View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14757_low_28 (Length: 248)
Name: NF14757_low_28
Description: NF14757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14757_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 36971943 - 36972154
Alignment:
| Q |
18 |
attctattgtacaaatttatgatgtacagagtacagacattctgcacgagtttattatggtttaccaattttgttttgtcccctcattgtctagaataca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36971943 |
attctattgtacaaatttatgatgtacagagtacagacattctgcacgagtttattatggtttaccaattttgttttgtcccctcattgtctagaataca |
36972042 |
T |
 |
| Q |
118 |
aacttaattctagctttagtagttaatgctgtcaaagaacagatgatggcacaattgctactaatttttataggtttctcaaatgcccgtgtctgaaaat |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36972043 |
aactcaattctagctttagtagttaatgctgtcaaagaacagatgatggcacaattgctactaatttttataggtttctcaaatgcccgtgtctgaaaat |
36972142 |
T |
 |
| Q |
218 |
ggatggtggtgg |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36972143 |
ggatggtggtgg |
36972154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University