View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14757_low_40 (Length: 210)
Name: NF14757_low_40
Description: NF14757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14757_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 34830024 - 34829932
Alignment:
| Q |
22 |
cttctttcaattcattgtttcatgatagtgatttttt-gttaaattagaattcagaatagtcttttccatcactctaggagtggataataaca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34830024 |
cttctttcaattcattgtttcatgatagtgatttttttgttaaattagaattcagaatagtcttttccatcactctaggagtggataataaca |
34829932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 131 - 202
Target Start/End: Complemental strand, 34829948 - 34829877
Alignment:
| Q |
131 |
aggagtggataataacatgaatggcctcaatcacctcttctgtcaataaatgtttttcaatcacttcatttc |
202 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34829948 |
aggagtggataataacatgaatgacctcaatcacctcttctgtcgataaatgtttttcaatcacttcatttc |
34829877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University