View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14757_low_8 (Length: 404)
Name: NF14757_low_8
Description: NF14757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14757_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 8e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 384
Target Start/End: Complemental strand, 14358434 - 14358354
Alignment:
| Q |
304 |
tacaattcatttcttgcaatttcttcctactcgtggacagttgtgaaaccttcaatctcttacattcctcttggctcaatt |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14358434 |
tacaattcatttcttgcaatttcttcctacttgtggacaattgtgaaaccttccatctcttacattcctcttggctcaatt |
14358354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University