View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_high_16 (Length: 362)
Name: NF14758_high_16
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 14 - 345
Target Start/End: Complemental strand, 41244568 - 41244240
Alignment:
| Q |
14 |
gaagacgacgaaaatgattatgttaattcatactaaactaaagaactaaacagtcctttatgtgataaatttaatattttaatgtcttagtttctttagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41244568 |
gaagacgacgaaaatgattatgttaattcatactaaactaaagaactaaacagtcctttatgtgataaatttaatattttaatgtcttagtttctttagt |
41244469 |
T |
 |
| Q |
114 |
ctggtttattaacttttagattatatgtaaatttgcaatttggggcagggctatatggtatgctttgttttgannnnnnnnccccctttggatatggctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41244468 |
ttggtttattaacttttagattatatgtaaatttgcaatttggggcagggctatatggtatgctttgttttgatttttttt-cccctttggatatggctg |
41244370 |
T |
 |
| Q |
214 |
aatattggagagggcttaattggggatgttgtcattttgtacataggagattttcttcaacagttgtgaaatgtgaagcatatatattattgaatgatga |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41244369 |
aatattggagagggcttaattggggatgttgtcattttgtacataggagattttcttcaacagttgtgaaatgtgaagc--atatattattgaatgatga |
41244272 |
T |
 |
| Q |
314 |
ttccatattaaatgttcttatcctgatacttc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41244271 |
ttccatattaaatgttcttatcctgatacttc |
41244240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University