View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_high_20 (Length: 292)
Name: NF14758_high_20
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 32 - 276
Target Start/End: Complemental strand, 30541036 - 30540792
Alignment:
| Q |
32 |
cacacgttccttcttctctcatcactcaacaaacaaccatgcaacaagcaattccttataggtcatggacacacaacacttccaccactcacttcaatgt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30541036 |
cacacgttccttcttctctcatcactcaacaaacaaccatgcaacaagcaattccttataggtcatggacacacaacacttccaccactcacttcaatgt |
30540937 |
T |
 |
| Q |
132 |
tatcaaaccacacatattaactacaactaaaatccacaatacaattgatgagtcctctcataggccctcctcctttaattttaatgaagaggacaaatca |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30540936 |
tatcaaaccacacatattaactacaactaaaatccacaatacaattgatgagtcttctcataggccctcctcctttaattttaatgaagaggacaaaaca |
30540837 |
T |
 |
| Q |
232 |
atgcttcataacatggtctcagagaacgcaattatagtctttgct |
276 |
Q |
| |
|
||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
30540836 |
atgtttcataacatggtatcagagaacgcagttatagtctttgct |
30540792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University