View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_high_22 (Length: 263)
Name: NF14758_high_22
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 38196374 - 38196620
Alignment:
| Q |
1 |
ttaagagtacaaaactagttacaaaaggtttaaaggaagatttgattaactctttggatgaagccgtgaccattgaaagcgtggatgctgaggtttccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196374 |
ttaagagtacaaaactagttacaaaaggtttaaaggaagatttgattaactctttggatgaagccgtgaccattgaaagcgtggatgctgaggtttccaa |
38196473 |
T |
|
| Q |
101 |
gaaggatgaggttgatggtttcattggaaatactgctgagctaaaggatgcagatagagagactgtagttgatgcagtagttgacacaggtgtaatgaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196474 |
gaaggatgaggttgatggtttcattggaaatactgttgagctaaaggatgcagatagagagactgtagttgatgcagtagttgacacaggtgtaatgaaa |
38196573 |
T |
|
| Q |
201 |
agttctgaaagtgttgaatcagatgaagagggtaacagtgcagtagt |
247 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196574 |
agttccgaaagtgttgaatcagatgaagagggtaacagtgcagtagt |
38196620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University