View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_high_24 (Length: 256)
Name: NF14758_high_24
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 52720068 - 52719895
Alignment:
| Q |
1 |
tggctggcacaaacttggttaacaaatggaggtttcacaagcattaagggtattaattataggctaaaatgttgttttggtcccttaacgnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52720068 |
tggctggcacaaacttggttaacaaatggaggcttcacaggcatttagggtattaattataggctaaaatgttgttttggtcccttaac---cttttttt |
52719972 |
T |
 |
| Q |
101 |
nnnagtatcgctttagtcaagtaataaaaaattcgtttagatctcttaagtccttctccgttatatgttttggtctc |
177 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52719971 |
tttagtattgctttagtcaagtaataaaaagtccgtttagatctcttaagtccttctccgttatatgttttggtctc |
52719895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 178 - 247
Target Start/End: Complemental strand, 52719763 - 52719694
Alignment:
| Q |
178 |
atctattgtaagtaatagtacaccatcaccatctcatattgtttttccctttcttccttttcttctctct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52719763 |
atctattgtaagtaatagtacaccatcaccatctcatattgtttttccctttcttccttttcttctctct |
52719694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 52711200 - 52711144
Alignment:
| Q |
1 |
tggctggcacaaacttggttaacaaatggaggtttcacaagcattaagggtattaat |
57 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | | |||||||||| ||||||||||| |
|
|
| T |
52711200 |
tggccggcacaaacttggttaacaaatggaagctccacaagcatttagggtattaat |
52711144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University