View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_18 (Length: 391)
Name: NF14758_low_18
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 18 - 375
Target Start/End: Complemental strand, 39365584 - 39365218
Alignment:
| Q |
18 |
acagagatgagggtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtacctt---------attttgtacat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39365584 |
acagagatgagggtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtaccttcgtttgcttattttgtacat |
39365485 |
T |
 |
| Q |
109 |
tttcatcttccttccaagcataaggtaatagtgatcatatgattttttgtatgtatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365484 |
tttcatcttccttccaagcataaggtaatagtgatcatatgattttttgtatttatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaag |
39365385 |
T |
 |
| Q |
209 |
gtgacggtgaatggttttgctgatcagaagaaggttctaaaaagggttcgaaaaactggacttagggctgagttatggcagcttcctcacacaacagaat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365384 |
gtgacggtgaatggttttgctgatcagaagaaggttctaaaaagggttcgaaaaactggacttagggctgagttatggcagcttcctcacacaacagaat |
39365285 |
T |
 |
| Q |
309 |
ctcaaagtcaatattatcaacaacacctttgcaatggccctatccctcattatgcttcacaaccttc |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365284 |
ctcaaagtcaatattatcaacaacacctttgcaatggccctatccctcattatgcttcacaaccttc |
39365218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University