View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_28 (Length: 289)
Name: NF14758_low_28
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 15 - 138
Target Start/End: Complemental strand, 2114776 - 2114653
Alignment:
| Q |
15 |
acaaacatccattgaactaagtaaacaccaccactgcagtctgcagttcacttctaatgcatttgaaatgataccgagcctgtaactaagccactgcacc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2114776 |
acaaacatccattgaactaagtaaacaccaccactgcagtctgcagttgacttctaatgcatttgaaatgataccgagcctgtaactaagccactgcacc |
2114677 |
T |
|
| Q |
115 |
gcagctctaacaatagcaatagat |
138 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2114676 |
gcagctctaacaatagcaatagat |
2114653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 137 - 244
Target Start/End: Complemental strand, 2114353 - 2114249
Alignment:
| Q |
137 |
ataataacatcccaaaaagaacattgttatggaattatatattgtaagaatatgactggttcttttttaaaatttt-atgatattttatcttttgtgttg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2114353 |
ataataacatcccaaaaagaacattgttatggaattat----tgtaagaatatgactcgatcttttttaaaatttttatgatattttatcttttgtgttg |
2114258 |
T |
|
| Q |
236 |
ttctctttg |
244 |
Q |
| |
|
||||||||| |
|
|
| T |
2114257 |
ttctctttg |
2114249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University