View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_38 (Length: 244)
Name: NF14758_low_38
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_38 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 244
Target Start/End: Complemental strand, 16181435 - 16181220
Alignment:
| Q |
24 |
acctgagccatttgatgaggagttagaacttagaaggggtgtgaaaacaagaaagaaaatgaaggctaagagaattttgatgaggcttttgtagtaccta |
123 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16181435 |
acctgagccatttgaagaggagttagaacttagaaggggtgtgaaaacaagaaagaaaatgaaggttaagagaattttgatgaggcttttgtagtaccta |
16181336 |
T |
 |
| Q |
124 |
tatagtattgttgttagtgggtaaagggtttgagtttttggaattgattcttcttttatttgtgcgtgtgactgtgtgagtcacatcaaaacagatggac |
223 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16181335 |
tatagta-----gttagtgggtaaagggtttgagattttggaattgatttttcttttatttgtgcgtgtgactgtgtgagtcacatcaaaacagatggac |
16181241 |
T |
 |
| Q |
224 |
ccttataaatgcaactttttt |
244 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16181240 |
ccttataaatgcaactttttt |
16181220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University