View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_41 (Length: 239)
Name: NF14758_low_41
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 47097244 - 47097060
Alignment:
| Q |
19 |
atggtggaacactaacttcagaatctccttccaacatctgcaacacctttgcaatagatggcctaatagttggattagggcacaagcaccacagtccaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47097244 |
atggtggaacactaacttcagaatctccttccaacatctgcaacacctttgcaatagatggcctaatagttggattaggacacaagcaccacagtccaac |
47097145 |
T |
 |
| Q |
119 |
catagtcattctctcaaacctaatgaaatcgttaacaacttcaacatcatgtcatggctaagaatgtctcttagtttcccctcttttgcc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||| |||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
47097144 |
catagtcattctctcaaacctattgaaatcattaacaacttcaaca-----tcattactaacaatgtctcttagtttcccttcttttgcc |
47097060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University