View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_46 (Length: 234)
Name: NF14758_low_46
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 16138568 - 16138366
Alignment:
| Q |
13 |
aagaatatacaatggtagaaaaactcacaaaagtgatggtggatcaggttgcatgcatggatgcgcgtaacgacatgcatcactggtgttcgacaatttt |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16138568 |
aagaaaatacaatggtagaaaaactcacaaaagtgatggtggatcaggttgcatgcatggatgcgtgtaacgacatgcatcactgttgttcgacaatttt |
16138469 |
T |
|
| Q |
113 |
tcggctacaatgaaaatatgattacacatactacattagttttgcatatttgatataaaggatatactctctattcaaacttcatattcatatttgatat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16138468 |
tcggctacaatgaaaatatgattacacatattacatttgttttgcatatttgatataaaggatatactctctattcaaacttcatattcatatttgatat |
16138369 |
T |
|
| Q |
213 |
aac |
215 |
Q |
| |
|
||| |
|
|
| T |
16138368 |
aac |
16138366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University