View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14758_low_46 (Length: 234)

Name: NF14758_low_46
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14758_low_46
NF14758_low_46
[»] chr5 (1 HSPs)
chr5 (13-215)||(16138366-16138568)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 16138568 - 16138366
Alignment:
13 aagaatatacaatggtagaaaaactcacaaaagtgatggtggatcaggttgcatgcatggatgcgcgtaacgacatgcatcactggtgttcgacaatttt 112  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||    
16138568 aagaaaatacaatggtagaaaaactcacaaaagtgatggtggatcaggttgcatgcatggatgcgtgtaacgacatgcatcactgttgttcgacaatttt 16138469  T
113 tcggctacaatgaaaatatgattacacatactacattagttttgcatatttgatataaaggatatactctctattcaaacttcatattcatatttgatat 212  Q
    |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16138468 tcggctacaatgaaaatatgattacacatattacatttgttttgcatatttgatataaaggatatactctctattcaaacttcatattcatatttgatat 16138369  T
213 aac 215  Q
    |||    
16138368 aac 16138366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University