View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_47 (Length: 233)
Name: NF14758_low_47
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 6 - 159
Target Start/End: Original strand, 1673819 - 1673969
Alignment:
| Q |
6 |
cataattcataacacatattcatcacattcactttctttgccccaagcttggttaccttttccttaaaccaaatacagttgacagcgactaaatatttaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673819 |
cataattcataacacatattcatcac-ttcactttctttgccccaagcttggttaccttttccttaaaccaaatacagttgacagcgactaaatatttaa |
1673917 |
T |
 |
| Q |
106 |
tcttgtcatctcatgagtcgtgaccttatcaacttagttatctaccttattaat |
159 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1673918 |
tcttgtcatctcatgagtcgtgaccttat--acttagttatctaccttattaat |
1673969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 160 - 221
Target Start/End: Original strand, 1674119 - 1674180
Alignment:
| Q |
160 |
gtattaaaatgaattataaaatcataaatgttataattattactactagattagttcatctc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1674119 |
gtattaaaatgaattataaaatcataaatgttataattattactactagattagttcatctc |
1674180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University