View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_49 (Length: 218)
Name: NF14758_low_49
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 25810014 - 25809819
Alignment:
| Q |
15 |
aaaaagggcatagccataatggatttcattctaaggttaggtgccatagcagcagctctcgcagctgctgcctcgatgggaactagtgatcaatctcttc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || || |||||||||||||| |||||||||||||||| |
|
|
| T |
25810014 |
aaaaagggcatagccataatggatttcattctaaggttaggtgccatagcagccgctctcgccgcggccgcctcgatgggaacaagtgatcaatctcttc |
25809915 |
T |
|
| Q |
115 |
ctttcttcactcagttctttcagtttgaagctagctatgatagctttcctgcattccagtatgtaacattcaaaactctacttcctatgtttctcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
25809914 |
ctttcttcactcagttctttcagtttgaagctagctatgatagttttcctgcattccagtatgtaacattcaaaactctactttctatgtctctcc |
25809819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 25816800 - 25816628
Alignment:
| Q |
15 |
aaaaagggcatagccataatggatttcattctaaggttaggtgccatagcagcagctctcgcagctgctgcctcgatgggaactagtgatcaatctcttc |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| | || ||||| |||||||||||||| |||||||| |||| | |
|
|
| T |
25816800 |
aaaaagggcacagccataatggatttcattctaaggttaggtgccatagcagcggctattgccgctgccgcctcgatgggaacaagtgatcagactctcc |
25816701 |
T |
|
| Q |
115 |
ctttcttcactcagttctttcagtttgaagctagctatgatagctttcctgcattccagtatgtaacattcaa |
187 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
25816700 |
ctttcttcactcagttctttcaatttgaagctagctatgatagctttacaaccttccagtatgtaacattcaa |
25816628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 25797981 - 25797818
Alignment:
| Q |
15 |
aaaaagggcatagccataatggatttcattctaaggttaggtgccatagcagcagctctcgcagctgctgcctcgatgggaactagtgatcaatctcttc |
114 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| ||||||||||| ||||| |||| || || || | | |||| |||||||||||| ||| | |
|
|
| T |
25797981 |
aaaaaaggcatagccataatggattttgttctaagattaggtgccattgcagcttctcttgctgcaactatcaccatggcaactagtgatcagattctcc |
25797882 |
T |
|
| Q |
115 |
ctttcttcactcagttctttcagtttgaagctagctatgatagctttcctgcattccagtatgt |
178 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||| | | ||||||||||| |
|
|
| T |
25797881 |
ctttcttcactcagttccttcaatttgaagctagttatgatagcttttcaactttccagtatgt |
25797818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University