View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14758_low_7 (Length: 488)
Name: NF14758_low_7
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14758_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 410; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 18 - 469
Target Start/End: Complemental strand, 45707406 - 45706962
Alignment:
| Q |
18 |
atgaaaaagtacacaacggtttactgataactggagacaattcgtaacaaatagtcacaaatgcattaattagaaactcacagcgaaatcataactaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45707406 |
atgaaaaagtacacaacggtttactgataactggagacaattcgtaacaaatagtcacaaatgcattaattagaaactcacagcgaaatcataactaaca |
45707307 |
T |
 |
| Q |
118 |
acaaaacatttgatttgcctcacttagcaaggacttcagtcttcaggtaattcacatatccatgtattcgagaataaaatttaattgcacagtgagggaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45707306 |
acaaaacatttgatttgcctcacttagcaaggacttcag-------gtaattcacatatccatgtattcgagaataaaatttaattgcatagtgagggaa |
45707214 |
T |
 |
| Q |
218 |
aaagtaaagcacacatcaccttaatatcatttctaattttattttaagctcacttagttgtttaatcatttagttcattaattactttcaatgggatttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45707213 |
aaagtaaagcacacatcaccttaatatcatttctaattttattttaagctcacttagttgtttaatcatttagttcattaattactttcaatgggatttg |
45707114 |
T |
 |
| Q |
318 |
ataattagctttgccccggacaaaataggcaattaaactgtccccgctcgtcctgcaaacacgatgtctatgatttcagatcgatatcgctcaccccctt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45707113 |
ataattagctttgccccggacaaaataggcaattaaactgtccctgctcgtcctgcaaacactatgtctatgatttcagatcgatatcgctcaccccctt |
45707014 |
T |
 |
| Q |
418 |
accttggcatgcttgactggcaaaatccttggttcctttgactcgctcctcc |
469 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45707013 |
accttggcatgcttgactggcaaaatccttggttcctttgactggctcctcc |
45706962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University