View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14759_low_2 (Length: 281)
Name: NF14759_low_2
Description: NF14759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14759_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 264
Target Start/End: Complemental strand, 15595842 - 15595589
Alignment:
| Q |
11 |
acatcatcatattggcgatacttctcatatagtagaacctcaagactcgatccaaagacctcggctgacctttaacatattctcatccttgacccaccat |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
15595842 |
acatcatcatattggcgatacttatcatatactagaacctcaagactcaatccaaagatctcggctgacccttaacatattctcatcctcgacccaccat |
15595743 |
T |
 |
| Q |
111 |
catggtagcttatcttctttcatccattaacttattgaaccttgttaacttatcattccttctttaattccctagaatcgagagatcacatctcgtttca |
210 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15595742 |
catggtagcttgacttcaatcatccattaacttactgaaccttcttaacttattattccttctttaattccctagaatcgagagatcacctctcgtttca |
15595643 |
T |
 |
| Q |
211 |
atccaccctaaagattctattttccacttactgttgcacttgtgttttcttagt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15595642 |
atccaccctaaagattctattttccacttactgttgcacttgtgttttcttagt |
15595589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University