View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1475_high_7 (Length: 308)
Name: NF1475_high_7
Description: NF1475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1475_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 45279357 - 45279110
Alignment:
| Q |
16 |
gatagtatagttgaaaaatatgtacatgttacattgtgaccggttgttaagaagtgcattctgtgtttgcaagttcaatgttgtttcaggatttattatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45279357 |
gatagtatagttgaaaaatatgtacatgttacattgtgaccggttgttaagaagtgcagtctgtgtttgcaagtttaatgttgtttcaggatttattatt |
45279258 |
T |
|
| Q |
116 |
gtgttagctctaattatactttaagccaattcttcttctatgatgattatgcattttgtagatgacagcaacaagaataaccaataagcttcacaatagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45279257 |
gtgttagctctaattatactttaagccaattcttcttctatgatgattatgcattttgtagatgacagcaaccagaataaccaataagcttcacaatagg |
45279158 |
T |
|
| Q |
216 |
aacttttttggtcaaacaacaaacagaagtcacttccatgttttgtgg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45279157 |
aacttttttggtcaaacaacaaacagaagtcacttccatgttttgtgg |
45279110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University