View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1475_low_18 (Length: 213)
Name: NF1475_low_18
Description: NF1475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1475_low_18 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 7 - 213
Target Start/End: Original strand, 35273323 - 35273529
Alignment:
| Q |
7 |
gttttctctggcaagactctcacccagtcggatgctaataatggcggtgcattctccgtaccttctgaatgcgcaaaattgatattcccgccacttgacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35273323 |
gttttctctggcaagactctcacccagtcggatgctaataatggcggtgcattctccgtaccttctgaatgcgcgaaattgatattcccgccacttgacc |
35273422 |
T |
|
| Q |
107 |
taacatccccaatgccgtctcacgtacttccgttcgcggacatccacaaatttgtttgggaatttcgccacccccaccgttggtctcccaagcgacaccc |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||||||| ||||||||| | ||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
35273423 |
taacatccccaatgccgtctcaggtacttccgatcaaggacatccacaattttgtttggaactttcgccacacctaccgtgggtctcccaagcgacacct |
35273522 |
T |
|
| Q |
207 |
aatcacc |
213 |
Q |
| |
|
||||||| |
|
|
| T |
35273523 |
aatcacc |
35273529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 17914371 - 17914471
Alignment:
| Q |
7 |
gttttctctggcaagactctcacccagtcggatgctaataatggcggtgcattctccgtaccttctgaatgcgcaaaattgatattcccgccacttgacc |
106 |
Q |
| |
|
|||| ||||||||| ||||| || | ||| ||||||||||| |||||||||||||| || ||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
17914371 |
gtttcctctggcaaaactctaactccgtctgatgctaataacggcggtgcattctcagtgcctagcgaatgcgcaaaattaatcttcccgccacttgacc |
17914470 |
T |
|
| Q |
107 |
t |
107 |
Q |
| |
|
| |
|
|
| T |
17914471 |
t |
17914471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 17976777 - 17976688
Alignment:
| Q |
18 |
caagactctcacccagtcggatgctaataatggcggtgcattctccgtaccttctgaatgcgcaaaattgatattcccgccacttgacct |
107 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||||||||||||| || || |||||||| ||||| || ||||||||||||||||| |
|
|
| T |
17976777 |
caagactctcaccccatctgatgctaacaatggcggtgcattctctgtgccagtggaatgcgcgaaattaatcttcccgccacttgacct |
17976688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 69
Target Start/End: Original strand, 8823326 - 8823388
Alignment:
| Q |
7 |
gttttctctggcaagactctcacccagtcggatgctaataatggcggtgcattctccgtacct |
69 |
Q |
| |
|
|||| |||||| |||||||| |||| || ||||||||||| || |||||||||||||||||| |
|
|
| T |
8823326 |
gtttcctctggaaagactctaaccctatctgatgctaataacggtggtgcattctccgtacct |
8823388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University