View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1475_low_2 (Length: 396)
Name: NF1475_low_2
Description: NF1475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1475_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 89 - 289
Target Start/End: Complemental strand, 1090608 - 1090417
Alignment:
| Q |
89 |
cagttcagttattctttattagttttctttcttgtttgttgtttatgctatagtgatttgtttattcatttatccgaatcatttatcggagtgaatcgta |
188 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| || |
|
|
| T |
1090608 |
cagttcagttattctttactagttttcttttttgtttgttgtttatgctatagtgatttgtttattcatttatccgaaccatttatcgtagtgaattgtg |
1090509 |
T |
|
| Q |
189 |
aattatgtgactaaaatatatagacaataacatggataataatttgaaaaattatgttaattcgatgtattatacgtgttgatgttggtgtcgcgacatg |
288 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1090508 |
aattatgtgactaaaatgtatagaca---------ataataatttgaaaaactatgttaattcaatgtattgtacgtgttgatgttggtgtcgcgacatg |
1090418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University