View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1475_low_3 (Length: 371)
Name: NF1475_low_3
Description: NF1475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1475_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 8 - 148
Target Start/End: Complemental strand, 48415824 - 48415684
Alignment:
| Q |
8 |
cgaagaaaatcaacatttttatcaatcacatgaggcacaccagcataaatttcaaccatcacaacaacaacaaacacattctttgggtgacattattgta |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48415824 |
cgaagaatatcaacatttttatcaatcacatgaggtacaccagcataaatttcaaccatcacaacaacaacaaacacattctttgggtgacattattgta |
48415725 |
T |
|
| Q |
108 |
aatcgttacatcgaatgcgaaggatccaatgccagagtatc |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48415724 |
aatcgttacattgaatgcgaaggatccaatgccagagtatc |
48415684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 222 - 353
Target Start/End: Complemental strand, 48415604 - 48415466
Alignment:
| Q |
222 |
ctcaacatatagttatatagaccgttctttataaaactaacaccatcatataaactcttctgagccacattatatgacatgtt-------ctgtacaatg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48415604 |
ctcaacatatagttatatagaccgttctttataaaactaacaccatcatataaactcttctgagccacattatatgacatgttctgataactgtacaatg |
48415505 |
T |
|
| Q |
315 |
agcccggaataaatgtacaaatctggttagctcgtggtt |
353 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48415504 |
agcccagaataaatgtacaaatctggttagctcgtggtt |
48415466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University