View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14760_low_3 (Length: 275)
Name: NF14760_low_3
Description: NF14760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14760_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 9499778 - 9499594
Alignment:
| Q |
1 |
ttagaggagtgggggatccacaaaaatgataggacaccataggtgggtcatgcagaagtggggaagtaattccccattttacatgcctgatgaaataacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499778 |
ttagaggagtgggggatccacaaaaatgataggacaccataggtgggtcatgcagaaatggggaagtaattccccattttacatgcctgatgaaataacg |
9499679 |
T |
 |
| Q |
101 |
gtcacgcatcactccttggatgtgttgggcagcggctacatttagctacccaaaatcggtgcaaccaactaccgtggcagagacc |
185 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9499678 |
gtcacgcaccactccttggatgcattggacagcggctacatttagctacccaaaatcagtgcaaccaactaccgtggcagagacc |
9499594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 219 - 263
Target Start/End: Complemental strand, 9499596 - 9499552
Alignment:
| Q |
219 |
accaaatacggtaaatctaaacacagctgtttcacttagaattat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499596 |
accaaatacggtaaatctaaacacagctgtttcacttagaattat |
9499552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University