View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14760_low_3 (Length: 275)

Name: NF14760_low_3
Description: NF14760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14760_low_3
NF14760_low_3
[»] chr4 (2 HSPs)
chr4 (1-185)||(9499594-9499778)
chr4 (219-263)||(9499552-9499596)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 9499778 - 9499594
Alignment:
1 ttagaggagtgggggatccacaaaaatgataggacaccataggtgggtcatgcagaagtggggaagtaattccccattttacatgcctgatgaaataacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
9499778 ttagaggagtgggggatccacaaaaatgataggacaccataggtgggtcatgcagaaatggggaagtaattccccattttacatgcctgatgaaataacg 9499679  T
101 gtcacgcatcactccttggatgtgttgggcagcggctacatttagctacccaaaatcggtgcaaccaactaccgtggcagagacc 185  Q
    |||||||| |||||||||||||  |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
9499678 gtcacgcaccactccttggatgcattggacagcggctacatttagctacccaaaatcagtgcaaccaactaccgtggcagagacc 9499594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 219 - 263
Target Start/End: Complemental strand, 9499596 - 9499552
Alignment:
219 accaaatacggtaaatctaaacacagctgtttcacttagaattat 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
9499596 accaaatacggtaaatctaaacacagctgtttcacttagaattat 9499552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University