View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14760_low_8 (Length: 227)
Name: NF14760_low_8
Description: NF14760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14760_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 86 - 227
Target Start/End: Original strand, 2084253 - 2084394
Alignment:
| Q |
86 |
gatgagacacaactaagtgtaaccttaggaagctatataacatcaagaccgccataattaatcatcctatgcttgaagaagttcaagatatgcaaactta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2084253 |
gatgagacacaactaagtgtaaccttaggaagctatataacatcaagaccgccataattaatcatcctatgcttgaagaagttcaagatatgcaaactta |
2084352 |
T |
 |
| Q |
186 |
taatgctcaagtgaaaagcataattgttgcatatcatataca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2084353 |
taatgctcaagtgaaaagcataattgttgcatatcatataca |
2084394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University