View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14761_low_8 (Length: 236)
Name: NF14761_low_8
Description: NF14761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14761_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 40187114 - 40187329
Alignment:
| Q |
3 |
caccgcttaattttttcttttgaacgaactgtagttaactaccgttggaggtggttttcatgtcttggctgttaaaaatttctaatgtatcacaaattat |
102 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40187114 |
caccgcttaattttctcttttgaacgaactgtagttaactaccgttggaggtgattttcatgtcttggctgttaaaaagttctaatgtatcacaaattat |
40187213 |
T |
 |
| Q |
103 |
tcaaaatcatgtgaatttggtggnnnnnnnnnncttttcttaattatgagtacaccctccggttgctgttataagtaagaattgactcaagtcgttatta |
202 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187214 |
tcaaaatcatgtgaatttggtgggttttttt---tcttcttaattatgagtacaccctccggttgctgttataagtaagaattgactcaagtcgttatta |
40187310 |
T |
 |
| Q |
203 |
aaataaagaccacatacat |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40187311 |
aaataaagaccacatacat |
40187329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University