View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14762_high_14 (Length: 286)
Name: NF14762_high_14
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14762_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 271
Target Start/End: Original strand, 33424343 - 33424604
Alignment:
| Q |
11 |
ttttcctatttttacgttgggatgacattgcttatttacctgcactcaactctcatagtcaacgtggcttttcattaaaattcaaaacaaaaacgcaaca |
110 |
Q |
| |
|
|||||| | |||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33424343 |
ttttccaaattttacattgtgatgacattgcttattgacctgcactcaactctcatagtcaacgtggcttttcattaaaattcaaaacaaaaacgcaaca |
33424442 |
T |
|
| Q |
111 |
aatcagctcgtacacgtgagagcgaatgaaatccctaat-agggtttcaaattttttgtgcttttagttgttactaaataaaatccatgctcaatataaa |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33424443 |
aatcagctcgtacctgtgagagcgaatgaaatccctaattagggtttcaaattttttgtgcttttagttgttactaaataaaatccatgctcaatataaa |
33424542 |
T |
|
| Q |
210 |
gatgaatggcactaagcataaaatgtgtgccaaattgggaggggtactaccaaatcatagag |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33424543 |
gatgaatggcactaagcataaaatgtgtgccaaattgggaggggtactaccaaatcatagag |
33424604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University