View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14762_low_13 (Length: 416)
Name: NF14762_low_13
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14762_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 28 - 362
Target Start/End: Complemental strand, 520153 - 519833
Alignment:
| Q |
28 |
gtgcatgtgtgtggagagaggacattaattaaaatattgaatatgcaagtatagatcctactcacttttgatttgatcatatatttattaattaatgaaa |
127 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
520153 |
gtgcatatatgtggagagaggacattaattaaaatattgaatatgcaagtatagatcctactcacttttgatttgatcatatatt----aattaatgaaa |
520058 |
T |
 |
| Q |
128 |
ctcttttgtttatagttattgtcaaagttacgtgcaatgcattggtgctgtctgtgacacacacatggtaccatccatgcacatggagagtttttcattc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
520057 |
ctcttttgtttatagttattgtcaaagttacgtgcaatgcattggtgctgtctgtgacacacacatggtaccat----gcacatggagagtttttcattc |
519962 |
T |
 |
| Q |
228 |
tccaaggttcttgttacaaacaactttttgatggtaagttgcaagggaccaaggggtcccggtccctctaagaaaaaccggtatggcattaattataatt |
327 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
519961 |
tccaaggttgttgttacaaacaacttttagatggtaagttgcaagggaccaaggggtcccggtccctctaagaaaaaccggtatggcatta------att |
519868 |
T |
 |
| Q |
328 |
aatttttataaatatagcaaactgctaaaaagaca |
362 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
519867 |
aatttatataaatatagcaaactgctaaaaagaca |
519833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University