View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14762_low_21 (Length: 306)
Name: NF14762_low_21
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14762_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 25693157 - 25692884
Alignment:
| Q |
18 |
cgattatttgcatggtctccttatccatccagcaagattggtttagacgtgggagtgttacgcctcagtttattggccatgtgtgtgttcatgatacaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25693157 |
cgattatttgcatggtctccttatccatccagcaagattggtttagacgtgggagtgttacgcctcagtttattggccatgtgtgtgttcatgatacaat |
25693058 |
T |
 |
| Q |
118 |
gtcatatattatacacggaaatatgcactagttaattgctttggaccttcttgtctcctgcatcacatggggtggaagagaaaattacgtggatagttta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25693057 |
gtcatatattatacacggaaatatgcactagttaattgctttggaccttcttgtctcctgcatcacatggggtggaagagaacattacgtggatagttta |
25692958 |
T |
 |
| Q |
218 |
tatgcctaacatttatatttataattacgtgtgtgcgtgtttcagtttaaattaattttaaaggagtgtctgtg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
25692957 |
tatgcctaacatttatatttataattacgtgtgtgcgtgtttcagtttaaattaattttgaaggagtgtttgtg |
25692884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University