View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14762_low_23 (Length: 266)
Name: NF14762_low_23
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14762_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 3 - 249
Target Start/End: Original strand, 2145461 - 2145707
Alignment:
| Q |
3 |
aattgtgctttcattttcttggggaccaatggtgggtcatcattgatgaggctttagtaatggctatttattagtgtcactaacaatacgttcaacatgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2145461 |
aattgtgctttcattttcttggggaccaatggtgggtcatcattgatgaggctttagtaatggctatttattagtgtcactaacaatacgttcaacatgc |
2145560 |
T |
 |
| Q |
103 |
ttcatagaaggtatattattgaaaatttattggagtctccaattgtcatggtctttcaattaagcaatgcatatgtggccaaattcattttatgagctag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2145561 |
ttcatagaaggtatattattgaaaatttattggagtctccaattgtcatggtctttcaattaagcaatgcatatgtggccaaattcattttatgagctag |
2145660 |
T |
 |
| Q |
203 |
tttttaagagtgggatctaaattcatttcatggtatcagagctggat |
249 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2145661 |
tttttaagagtgggatctaaatccatttcatggtatcagagctggat |
2145707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University