View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14762_low_24 (Length: 264)
Name: NF14762_low_24
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14762_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 41 - 248
Target Start/End: Original strand, 51352185 - 51352393
Alignment:
| Q |
41 |
cagagaccgaaatatagatattttatgcaaatctgtaatattcattcatattcaatt-gtgagctaccccctctcaagtgtagactcaattgtctacaca |
139 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51352185 |
cagagatcgagatatagatattttatgcaaatccgtaatattcattcatattcaatttgtgagctaccccctctcaagtgtagactcaattgtctacaca |
51352284 |
T |
 |
| Q |
140 |
ttaaaattgcgtaaccccgttgtagttgttcaggaacttcatcaacgtcctcaggcctgtaacaacaacaacaaaatgaatcattcatccaatattaaaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51352285 |
ttaaaattgcgtaaccccgttgtagttgttcaggaacttcatcaacgtcctcaggcctgtaacaacaacaacaaaatgaatcattcatccaatattaaaa |
51352384 |
T |
 |
| Q |
240 |
tttaaaaac |
248 |
Q |
| |
|
||||||||| |
|
|
| T |
51352385 |
tttaaaaac |
51352393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University