View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14762_low_27 (Length: 246)
Name: NF14762_low_27
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14762_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 31827628 - 31827763
Alignment:
| Q |
1 |
tgtgtgatagaagaccaaatgtaagaatagcagtagtagtgttggagtatataagctgaagcctcactttactgacccctattgtgtagaactacaagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31827628 |
tgtgtgatagaagaccaaatgtaagaatagcagtagtagtgttggagtatataagctgaagcctcactttactga-ccctattgtgtagaactacaagtt |
31827726 |
T |
 |
| Q |
101 |
atttgtttgagtgaattcttttcttgagaagtgctta |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31827727 |
atttgtttgagtgaattcttttcttgagaagtgctta |
31827763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 31827799 - 31827848
Alignment:
| Q |
173 |
ctgttcagaatcagacaccattctgtgttctgtgttctctataataacca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31827799 |
ctgttcagaatcagacaccattctgtgttctgtgttctctataataacca |
31827848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University