View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14763_low_11 (Length: 233)
Name: NF14763_low_11
Description: NF14763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14763_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 168
Target Start/End: Complemental strand, 36695127 - 36694973
Alignment:
| Q |
14 |
aattctagttggtggattaatttctgtgttggttaacattttcttgggccctgtttgggctggtggtgatcttcacaatctagcatcaaaaaacattgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36695127 |
aattctagttggtggattaatttctgtgttggttaacattttcttgtgccctgtttgggctggtggtgatcttcacaatctagcatcaaaaaacatcgaa |
36695028 |
T |
 |
| Q |
114 |
aaacttggcaactttttagaaggtgtgcaagcaagacaattttgtaaattctgat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695027 |
aaacttggcaactttttagaaggtgtgcaagcaagacaattttgtaaattctgat |
36694973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University