View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14765_low_8 (Length: 236)

Name: NF14765_low_8
Description: NF14765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14765_low_8
NF14765_low_8
[»] chr4 (2 HSPs)
chr4 (1-221)||(45913655-45913875)
chr4 (173-208)||(45907574-45907609)
[»] scaffold0440 (1 HSPs)
scaffold0440 (85-123)||(8435-8473)
[»] chr1 (1 HSPs)
chr1 (85-123)||(1954462-1954500)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45913875 - 45913655
Alignment:
1 ttggttaaaacgaagtttaagcattggttgtaaagatgtcacgaaacacatatcattggacgggatactacatggaaaactatatagacctaagaatttt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
45913875 ttggttaaaacgaagtttaagcattggttgtaaagatgtcacgaaacacatatcattggacgggataccacatggaaaactatatagacctaagaatttt 45913776  T
101 tgctgtccactttgaaggattcagataaagagactgaatttttgttttggttggcttgcatagttgcatttttcaagtattgggtgtagtgtttctttaa 200  Q
    ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45913775 tgctgtccactttgaaggattcagataaagagactaaatatttgttttggttggcttgcatagttgcatttttcaagtattgggtgtagtgtttctttaa 45913676  T
201 tggagtctctggtgtctggtt 221  Q
    |||||||||||||||||||||    
45913675 tggagtctctggtgtctggtt 45913655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 208
Target Start/End: Complemental strand, 45907609 - 45907574
Alignment:
173 tcaagtattgggtgtagtgtttctttaatggagtct 208  Q
    |||||||||||||||||||| |||||||||||||||    
45907609 tcaagtattgggtgtagtgtgtctttaatggagtct 45907574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0440 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0440
Description:

Target: scaffold0440; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 8473 - 8435
Alignment:
85 tagacctaagaatttttgctgtccactttgaaggattca 123  Q
    ||||||||||||||||||||||| |||||||||||||||    
8473 tagacctaagaatttttgctgtcgactttgaaggattca 8435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 1954500 - 1954462
Alignment:
85 tagacctaagaatttttgctgtccactttgaaggattca 123  Q
    ||||||||||||||||||||||| |||||||||||||||    
1954500 tagacctaagaatttttgctgtcgactttgaaggattca 1954462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University