View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14765_low_8 (Length: 236)
Name: NF14765_low_8
Description: NF14765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14765_low_8 |
 |  |
|
| [»] scaffold0440 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45913875 - 45913655
Alignment:
| Q |
1 |
ttggttaaaacgaagtttaagcattggttgtaaagatgtcacgaaacacatatcattggacgggatactacatggaaaactatatagacctaagaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45913875 |
ttggttaaaacgaagtttaagcattggttgtaaagatgtcacgaaacacatatcattggacgggataccacatggaaaactatatagacctaagaatttt |
45913776 |
T |
 |
| Q |
101 |
tgctgtccactttgaaggattcagataaagagactgaatttttgttttggttggcttgcatagttgcatttttcaagtattgggtgtagtgtttctttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45913775 |
tgctgtccactttgaaggattcagataaagagactaaatatttgttttggttggcttgcatagttgcatttttcaagtattgggtgtagtgtttctttaa |
45913676 |
T |
 |
| Q |
201 |
tggagtctctggtgtctggtt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45913675 |
tggagtctctggtgtctggtt |
45913655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 208
Target Start/End: Complemental strand, 45907609 - 45907574
Alignment:
| Q |
173 |
tcaagtattgggtgtagtgtttctttaatggagtct |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45907609 |
tcaagtattgggtgtagtgtgtctttaatggagtct |
45907574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0440 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0440
Description:
Target: scaffold0440; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 8473 - 8435
Alignment:
| Q |
85 |
tagacctaagaatttttgctgtccactttgaaggattca |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8473 |
tagacctaagaatttttgctgtcgactttgaaggattca |
8435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 1954500 - 1954462
Alignment:
| Q |
85 |
tagacctaagaatttttgctgtccactttgaaggattca |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1954500 |
tagacctaagaatttttgctgtcgactttgaaggattca |
1954462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University