View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14766_low_10 (Length: 291)
Name: NF14766_low_10
Description: NF14766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14766_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 280
Target Start/End: Complemental strand, 25901445 - 25901184
Alignment:
| Q |
19 |
gattccacctcaaaaaccagcattggaattgattatatagtgagttattggaaattgatttagttttgtatatagggaattttatgagaggctgatcaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25901445 |
gattccacctcaaaaaccagcattggaattgattatatagtgagttattggaaattgatttagttttgtatatagggaattttatgagaggctgatcaat |
25901346 |
T |
|
| Q |
119 |
tggannnnnnnnnnnnctagtttaaatttctttggatattattcctttaatttctttggattgatgcaagaaaattttagacttgtgaagatatatattc |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25901345 |
tggatttttgttttttctagtttaaatttctttggatattattcctttaatttctttggattgatgcaagaaaattttagacttgtgaagatatatattc |
25901246 |
T |
|
| Q |
219 |
aaaagaagacaactgaaatgatactattttttgtgataatctctcctccattaatttctcat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25901245 |
aaaagaagacaactgaaatgatactattttttgtgataatctctcctccattaatttctcat |
25901184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University