View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14766_low_12 (Length: 247)
Name: NF14766_low_12
Description: NF14766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14766_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 30620974 - 30620754
Alignment:
| Q |
20 |
atcccttgtcacaaagctactcggtcgcatttactaccatgtcgatggagctgaaaagccaggatcgttgccaccaaacgttgcagcagcagttaatggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620974 |
atcccttgtcacaaagctactcggtcgcatttactaccatgtcgatggagctgaaaagccaggatcgttgccaccaaacgttgcagcagcagttaatggc |
30620875 |
T |
|
| Q |
120 |
gttgcttttgttgggacactttctggacaactctttttcggctggctcggtgacaaactaggccgtaaaaaagtctatggcatgactctagctgttatgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620874 |
gttgcttttgttgggacactttctggacaactcttcttcggctggctcggtgacaaactaggccgtaaaaaagtctatggcatgactctagctgttatgg |
30620775 |
T |
|
| Q |
220 |
ttgtttgttccacaggttctg |
240 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
30620774 |
ttgtttgttccataggttctg |
30620754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 24 - 209
Target Start/End: Complemental strand, 30616219 - 30616034
Alignment:
| Q |
24 |
cttgtcacaaagctactcggtcgcatttactaccatgtcgatggagctgaaaagccaggatcgttgccaccaaacgttgcagcagcagttaatggcgttg |
123 |
Q |
| |
|
||||| |||| |||||||||||| || || ||| ||||||| ||||||||| |||| ||| | ||||||||||||||||||||| ||||||| ||| | | |
|
|
| T |
30616219 |
cttgttacaaggctactcggtcgtatatattactatgtcgacggagctgaagagcctggaacattgccaccaaacgttgcagcaacagttaacggcctcg |
30616120 |
T |
|
| Q |
124 |
cttttgttgggacactttctggacaactctttttcggctggctcggtgacaaactaggccgtaaaaaagtctatggcatgactcta |
209 |
Q |
| |
|
|||| ||||| ||| || | ||||||||||| ||||||||||||||||||||||||||||||| || ||||||||| || |||||| |
|
|
| T |
30616119 |
ctttagttggaacatttaccggacaactcttcttcggctggctcggtgacaaactaggccgtagaacagtctatggaatcactcta |
30616034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University