View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14766_low_8 (Length: 375)
Name: NF14766_low_8
Description: NF14766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14766_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 7 - 363
Target Start/End: Complemental strand, 208693 - 208338
Alignment:
| Q |
7 |
gaaaatgctttggtaaaaggtttgaggcatgtcaaatagagctcacttgctggcaaccactaggcatcaacaccggatcatcttagactcctcgcaggag |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
208693 |
gaaaatgctttggtaaaaggttcgaggcatgtcaaatagagctcacttgctggcaactactaggcatcaacaccggatcatcttagactcctcgcaggag |
208594 |
T |
|
| Q |
107 |
ttacttttttccactactactaatttcgttgcatcaggttggaagcagagtatagtgaagagattttatacaatagttttattctccaaatagcagctta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
208593 |
ttacttttttccactactactaatttcgttgcatcaggttggaagcagagtatagtgaagagattttatacaatagttttattctccaaatagcagctta |
208494 |
T |
|
| Q |
207 |
ttaaatttagcttggtcttatagccaatttattggttgtggatgacaatttggcttggtgtttagctgattaaggaattgtttgagaccgttgagagctg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
208493 |
ttaaatttagcttggtcttatagccaatttattggttgtggatgacaatttggcttggtctttagctgattaa-gaattgtttgagaccattgagagctg |
208395 |
T |
|
| Q |
307 |
gttaactttggaataagaattactgtagacttccgtaacgtagtcaaaattgtttag |
363 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
208394 |
gttaactttggaataagaattacggtagacttccgtaacgtagtcaaaattgtttag |
208338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University