View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14769_high_6 (Length: 217)
Name: NF14769_high_6
Description: NF14769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14769_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 11 - 201
Target Start/End: Complemental strand, 7632101 - 7631911
Alignment:
| Q |
11 |
tgagatgaaaatggcgaaattatcagtttgcaaatttattgttatgaaactaatacatttttatcctctttagataaacaatttaattaattttttatac |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||| | ||||| ||| | |||||||||||||||||||||||||| |||||||| |
|
|
| T |
7632101 |
tgagatgaaaatgacgaaattatcagtttgcaaattcattgttatgaaatttatacactttgaccctctttagataaacaatttaattaagtttttatag |
7632002 |
T |
 |
| Q |
111 |
tataggtgcttatcatatataannnnnnnaagtatatgtaatttctacaatatagaatgaaataaagttgaataagatacatgtcataagt |
201 |
Q |
| |
|
|||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7632001 |
tataagtgtttatcatatataatttttttaagtatatgtaatttctacaatatagaatgaaataaagttgaataagatacatgtcataagt |
7631911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University