View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14769_low_11 (Length: 204)
Name: NF14769_low_11
Description: NF14769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14769_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 11 - 145
Target Start/End: Complemental strand, 37762657 - 37762523
Alignment:
| Q |
11 |
tgaaaccatgaaacgaattgaaagttgtctgccattgtaaggggacaatatggagtagagttgttcgatgttttgggcttgtgcgattgaggttagtagt |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37762657 |
tgaaatcatgaaacgaattgaaagttgtctgccattgtaaggggacaatatggagtagagttgttcgatgttttgggtttgtgcgattgaggttagtagt |
37762558 |
T |
|
| Q |
111 |
tcattcatgtcgacgctacggtccatgtacgggga |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37762557 |
tcattcatgtcgacgctacggtccatgtacgggga |
37762523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University