View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14769_low_6 (Length: 224)
Name: NF14769_low_6
Description: NF14769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14769_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 26810391 - 26810185
Alignment:
| Q |
1 |
atagaagaaagagttcagggggaactaatgtacaacaataactatggaaaataataacaaaggaactggacccattaacccaaagccaatattttggctg |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26810391 |
atagaagaaagagtttagagggaactaatgtacaacaataactatggaaaataataacaaaggaactggacccattaacccaaagccaatattttggctg |
26810292 |
T |
|
| Q |
101 |
acccatgagcccaaaaattcaatgcaaaatcgaaacttgagattgaagttgtgtctggtgtctgccaccgacatgaaaatgacacaggcagttacattca |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26810291 |
acccatgagcccaaaaattctatgcaaaatcgaaacttaagattgaagttgtgtctggtgtccgccaccgacatgaaaatgacacaggcagttacattca |
26810192 |
T |
|
| Q |
201 |
tagcaaa |
207 |
Q |
| |
|
||||||| |
|
|
| T |
26810191 |
tagcaaa |
26810185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 26810173 - 26810140
Alignment:
| Q |
125 |
caaaatcgaaacttgagattgaagttgtgtctgg |
158 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
26810173 |
caaaatcgaaacttcagattgaagttgtgtctgg |
26810140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University