View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1476_low_8 (Length: 243)
Name: NF1476_low_8
Description: NF1476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1476_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 31755513 - 31755384
Alignment:
| Q |
1 |
gattggaatagttgctggctccattgtccaaacaatttttctttccatcattacatctcttacgaattggaaaaaacaggtctatattttatgaattcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31755513 |
gattggaatagttgctggctccattgtccaaacaatttttctctccatcattacatctcttacgaattggaaaaaacaggtctatattttatgaattcaa |
31755414 |
T |
|
| Q |
101 |
ttctatcattattattcaatatatatgttt |
130 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
31755413 |
ttctatcattattattcaatatacatgttt |
31755384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 31755383 - 31755325
Alignment:
| Q |
169 |
ttaataatacaagataaatgcaacttttgtaggcaatcatggcaagagagagaatattt |
227 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31755383 |
ttaataatacaaggtaaatgcaacttttgtaggcaatcatggcaagagagagaatattt |
31755325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University