View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_high_16 (Length: 343)
Name: NF14771_high_16
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 22 - 257
Target Start/End: Original strand, 37974416 - 37974648
Alignment:
| Q |
22 |
atgacaataacaaagaccaagacaagaggttcctatacatctttatgacttcaattactgcgtgtgatccagattcactttagtactatattcatcatgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37974416 |
atgacaataacaaagaccaagacaagaggttcctatacatctttatgagttcaattactgcgtgtgatccagattcactttaatactatattcatcatgt |
37974515 |
T |
 |
| Q |
122 |
tgttccaattatggtttttaaatattgattcccacttcgctcatgggtgtatgtttggattcacgttttaagaagtgtctgtttgattaagcgtctcaag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
37974516 |
tgttccaattatggtttttaaatattgattcccactttgcttatgggtgaatgtttggattgacgtttt---aagtgtctgtttgattaagcgtcccaag |
37974612 |
T |
 |
| Q |
222 |
ttggcatatgtagcttctgcctaaaggtgatttttt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37974613 |
ttggcatatgtagcttctgcctaaaggtcatttttt |
37974648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University