View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_high_33 (Length: 230)
Name: NF14771_high_33
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 47 - 214
Target Start/End: Original strand, 9037203 - 9037369
Alignment:
| Q |
47 |
aattaatacgttgttctgaaattggtatgctctcttggctaagttacgtttgttaattctcttacttcaaatcagtagacaacatttaaatgcacaatat |
146 |
Q |
| |
|
|||||||| |||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9037203 |
aattaatatgttgttctgaaattggtatgtttacttggctaagttacctttgttaattctcttacttcaaatcagtagacgacatttaaatgcacaatat |
9037302 |
T |
|
| Q |
147 |
gtaagcatctcaaatgcacaatatggcatctccaatgccactataaaaaggcacaacatggttttcta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9037303 |
gtaagcatctcaaatgcacaatatggcatctccaatg-cactataaaaaggcacaacatggttttcta |
9037369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University