View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14771_high_36 (Length: 209)

Name: NF14771_high_36
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14771_high_36
NF14771_high_36
[»] chr3 (1 HSPs)
chr3 (16-131)||(10797144-10797259)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 10797144 - 10797259
Alignment:
16 tcactatcgaacccggcaccctccctgccttaacagcaacagccaaatccgccggaaaactctccattgaccttccaacctcagccaaaaccagcattgc 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||    
10797144 tcactatcgaacccggcaccctccctgccttaacagcaacagccaaatccaccggaaaactctccattgaccttccaacctcagctaaaaccagcattgc 10797243  T
116 ctcttctctatttctg 131  Q
    ||||||||||||||||    
10797244 ctcttctctatttctg 10797259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University