View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_high_9 (Length: 440)
Name: NF14771_high_9
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 176 - 422
Target Start/End: Complemental strand, 12165235 - 12164989
Alignment:
| Q |
176 |
gtgtccgcatccgtgcttcatagtttacaaccaatataaacaatttgatttgattttatcttttactataagagcttaattaagttgtttattcaaccga |
275 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12165235 |
gtgtctgcatccgtgcttcatagtttacaaccaatataaacaattttattttattttatcttttgctataagagcttaattaagttgtttattcaaccga |
12165136 |
T |
 |
| Q |
276 |
atacgatggatttgtgttcataatggtgattttttgttgtggttgcagcattcagtgttattgatagagcttgttgtggtcttggaaggaatagaggcca |
375 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12165135 |
agacgatggatttgtgttcataatggtgattttttgttgtggttgcagcattcagtgttattgatagagcttgttgtggtcttggaaggaatagaggcca |
12165036 |
T |
 |
| Q |
376 |
aatatcatgtctcccaatgcaatttccatgtgcaaacagagcacaat |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12165035 |
aatatcatgtctcccaatgcaatttccatgtgcaaacagagcacaat |
12164989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 13 - 119
Target Start/End: Complemental strand, 12165434 - 12165328
Alignment:
| Q |
13 |
cagagaccattctgatgccaagtttgtatatggaaacacttatggtgtctttggtgatattcttaataaccctgctgcctatggtaagatataatactac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12165434 |
cagagaccattctgatgccaagtttgtatatggaaacacttatggtgtctttggtgatattcttaataaccctgctgcctatggtaagatttaatactac |
12165335 |
T |
 |
| Q |
113 |
taataat |
119 |
Q |
| |
|
||||||| |
|
|
| T |
12165334 |
taataat |
12165328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 155 - 198
Target Start/End: Complemental strand, 14216885 - 14216843
Alignment:
| Q |
155 |
tcagtatccgtgtcagtgtctgtgtccgcatccgtgcttcatag |
198 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14216885 |
tcagtgtccgtgtc-gtgtctgtgtccgcatccgtgcttcatag |
14216843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 155 - 198
Target Start/End: Complemental strand, 14223014 - 14222972
Alignment:
| Q |
155 |
tcagtatccgtgtcagtgtctgtgtccgcatccgtgcttcatag |
198 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14223014 |
tcagtgtccgtgtc-gtgtctgtgtccgcatccgtgcttcatag |
14222972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 243 - 271
Target Start/End: Complemental strand, 48588592 - 48588564
Alignment:
| Q |
243 |
ataagagcttaattaagttgtttattcaa |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48588592 |
ataagagcttaattaagttgtttattcaa |
48588564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 164 - 198
Target Start/End: Complemental strand, 19213807 - 19213773
Alignment:
| Q |
164 |
gtgtcagtgtctgtgtccgcatccgtgcttcatag |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19213807 |
gtgtcagtgtccgtgtccgcatccgtgcttcatag |
19213773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 163 - 197
Target Start/End: Complemental strand, 25791650 - 25791616
Alignment:
| Q |
163 |
cgtgtcagtgtctgtgtccgcatccgtgcttcata |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
25791650 |
cgtgtcagtgtctgtgtccgtatccgtgcttcata |
25791616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 213 - 246
Target Start/End: Original strand, 11560630 - 11560663
Alignment:
| Q |
213 |
aaacaatttgatttgattttatcttttactataa |
246 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
11560630 |
aaacaatttgatttgattttatcttttgctataa |
11560663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University