View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_low_24 (Length: 283)
Name: NF14771_low_24
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 263
Target Start/End: Original strand, 41042666 - 41042915
Alignment:
| Q |
14 |
ttatacttgctacattagaaattaggatagagatctttagacaaaataataaaaaacaaccaagctcgtcggaagttttgttttgaaataaatttgtcag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41042666 |
ttatacttgctacattagaaattaggatagagatctttagacaaaataataaaaaacaaccaagctcgtcagaagttttgttttgaaataaatttgtcag |
41042765 |
T |
|
| Q |
114 |
aattttttgtttaatcggtaaaaatattgaaattgtcagattgaatattgtgatagagattcgaacataacttatatacatatgtgaaagtttttaatga |
213 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
41042766 |
aatttcttgtttaatcggtaaaaatattgaaattgtcagattgaatattgtgatagagattcgaacataacttatctacatgtgtaaaagtttttaatga |
41042865 |
T |
|
| Q |
214 |
ttgttatcattccgtctatctaaaaaacaacgaaactcaccatgcattat |
263 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||||||| |||||| |||| |
|
|
| T |
41042866 |
ttgttatcatttcgtctatttaaaagacaacgaaactcgccatgcgttat |
41042915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University