View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_low_30 (Length: 249)
Name: NF14771_low_30
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 2 - 232
Target Start/End: Complemental strand, 40859797 - 40859572
Alignment:
| Q |
2 |
atttatgaaggatcggtaagaatgagagggaagcgaaaataagtagaaatggttttgaaagtgggaggtagcactatctaaaacttgggctataattaat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40859797 |
atttatgaaggatcggtaagaatgagagggaagcgaaaataagtagaaatggttttgaaagtgggaggtagcactatctaaaacttgggctataa----- |
40859703 |
T |
 |
| Q |
102 |
atagccaacttctcaaatgaaggtaagaagactgattacttagcttccctacaacttacaattactggggtaatatttttaccttgtaagtttgcaacag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40859702 |
atagccaacttctcaaatgaaggtaagaagactgattacttagcttccctacaacttacaattactggggtaatatttttaccttgtaagtttgcaacag |
40859603 |
T |
 |
| Q |
202 |
aatactgttgtagttttggtgagtataattt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40859602 |
aatactgttgtagttttggtgagtataattt |
40859572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University