View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_low_31 (Length: 245)
Name: NF14771_low_31
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_low_31 |
 |  |
|
| [»] scaffold0754 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0754 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: scaffold0754
Description:
Target: scaffold0754; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 67 - 232
Target Start/End: Complemental strand, 5880 - 5712
Alignment:
| Q |
67 |
ttcaaatttaaagaagaaacttgcgaa----gttccttgaaagttataagacatacaaaattcatgcaacatatgacttagnnnnnnnnnnnnnnnnacg |
162 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
5880 |
ttcaaatttaaagaagaaacttgtgaaaaaagttccttgaaagttataagacatacaaaattcatgcaacatatgagttagttttttttttttttt-acg |
5782 |
T |
 |
| Q |
163 |
gacaaaatgagttagtttattgtttgtatatatattgtaaaatcaaactcaaagcatagaagttcatttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5781 |
aacaaaatgagttagtttattgtttgtctatatattataaaatcaaactcaaagcatagaagttcatttc |
5712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0754; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 5 - 67
Target Start/End: Complemental strand, 5983 - 5921
Alignment:
| Q |
5 |
aagtttattcgaagaaaattgtaaatctacgacaatttgtcatacaaagagtgttcaagaagt |
67 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5983 |
aagtttatttgaagaaaattgtaaatctacgacaatttgtcatacaaagagtgttcaagaagt |
5921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 67 - 232
Target Start/End: Original strand, 22221433 - 22221601
Alignment:
| Q |
67 |
ttcaaatttaaagaagaaacttgcgaa----gttccttgaaagttataagacatacaaaattcatgcaacatatgacttagnnnnnnnnnnnnnnnnacg |
162 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
22221433 |
ttcaaatttaaagaagaaacttgtgaaaaaagttccttgaaagttataagacatacaaaattcatgcaacatatgagttagttttttttttttttt-acg |
22221531 |
T |
 |
| Q |
163 |
gacaaaatgagttagtttattgtttgtatatatattgtaaaatcaaactcaaagcatagaagttcatttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22221532 |
aacaaaatgagttagtttattgtttgtctatatattataaaatcaaactcaaagcatagaagttcatttc |
22221601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 5 - 67
Target Start/End: Original strand, 22221330 - 22221392
Alignment:
| Q |
5 |
aagtttattcgaagaaaattgtaaatctacgacaatttgtcatacaaagagtgttcaagaagt |
67 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22221330 |
aagtttatttgaagaaaattgtaaatctacgacaatttgtcatacaaagagtgttcaagaagt |
22221392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University