View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_low_35 (Length: 236)
Name: NF14771_low_35
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 19206136 - 19206362
Alignment:
| Q |
11 |
atatatattaataatattacaagcatctttatttcgtgacaagtgtttcaccaccttcacttgatggatcccaactagggggtttgatattttgtcatct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
19206136 |
atatatattaataatattacaagcatctttatttcgtgacaagtgtttcaccaccttcacttgatggatcccaactagggggtttgatgttttgccatct |
19206235 |
T |
 |
| Q |
111 |
agattcttttgacacaaaatct--------------annnnnnnnnaaacgaacccgaagtctatcgatactaatcgatttttaaccttcttgttttcag |
196 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19206236 |
agattcttttgacacaaaatctatttatttttttttaaactgaaacaaacgcacccgaagtctatcgaaactaatcgatttttaaccttcttgttttcag |
19206335 |
T |
 |
| Q |
197 |
tctccattttcatcccatatagaaggt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19206336 |
tctccattttcatcccatatagaaggt |
19206362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 22 - 98
Target Start/End: Complemental strand, 12408697 - 12408621
Alignment:
| Q |
22 |
taatattacaagcatctttatttcgtgacaagtgtttcaccaccttcacttgatggatcccaactagggggtttgat |
98 |
Q |
| |
|
||||||||||||||| ||||| |||| |||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12408697 |
taatattacaagcattattattgcgtgccaagagtttcaccaccttcacttgatggatcccaaccagggggtttgat |
12408621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University