View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14771_low_39 (Length: 209)
Name: NF14771_low_39
Description: NF14771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14771_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 10797144 - 10797259
Alignment:
| Q |
16 |
tcactatcgaacccggcaccctccctgccttaacagcaacagccaaatccgccggaaaactctccattgaccttccaacctcagccaaaaccagcattgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10797144 |
tcactatcgaacccggcaccctccctgccttaacagcaacagccaaatccaccggaaaactctccattgaccttccaacctcagctaaaaccagcattgc |
10797243 |
T |
 |
| Q |
116 |
ctcttctctatttctg |
131 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10797244 |
ctcttctctatttctg |
10797259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University