View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14772_low_5 (Length: 238)
Name: NF14772_low_5
Description: NF14772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14772_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 42426833 - 42427040
Alignment:
| Q |
19 |
catccgacatctgaattaagagaagatacagactccctcaagtacacannnnnnnatactgttgctagatcaaatcaagcactaacttacgtgtttgaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42426833 |
catccgacatctgaattaagagaagatacagactccctcaagcacacatttttttatactgttgctagatcaaatcaagcactaacttacgtgtttgaat |
42426932 |
T |
 |
| Q |
119 |
aacctttcaagtacaccccctggtctactctacattttttgtcgagtacggtagttcaaccactcataacagttctatagaatctcggatctcaacaaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42426933 |
aacctttcaagtacaccccctggtctactctacattttttgtcgagtacggtagttcaaccactcataacagttctatagaatctcggatctcaacaaca |
42427032 |
T |
 |
| Q |
219 |
ctagatgt |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
42427033 |
ctagatgt |
42427040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University