View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14772_low_6 (Length: 211)
Name: NF14772_low_6
Description: NF14772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14772_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 38672444 - 38672621
Alignment:
| Q |
17 |
aaacaaactcgggcttaacacaaaaaatgccagaggtgtcataccttatctcttacataacgcggtagggcaattgatgcaaggttacacacagcagtct |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38672444 |
aaacaaactcgggcctaacacaaaaaatgccagaggtgtcataccttatctcttacataacgtggtagggcaattgatgcaaggttacacacagcagtct |
38672543 |
T |
|
| Q |
117 |
ctgttggacttgtatactcgattatctcagtgcacagatttgatgacttaattgtgcccagattctgctggttgcttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38672544 |
ctgttggacttgtatactcgattatctcagtgcacagatttgatgacttaattgtgcccagattctgctggttgcttt |
38672621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 60 - 194
Target Start/End: Original strand, 2060443 - 2060577
Alignment:
| Q |
60 |
ccttatctcttacataacgcggtagggcaattgatgcaaggttacacacagcagtctctgttggacttgtatactcgattatctcagtgcacagatttga |
159 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2060443 |
ccttatctcttacaaaacgcggtagtgcaattgatgcaaggttacacacagcagtctctgttggacttgtatactggattatctcagtgcacagatttga |
2060542 |
T |
|
| Q |
160 |
tgacttaattgtgcccagattctgctggttgcttt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2060543 |
tgacttaattgtgcccagattctgctggttgcttt |
2060577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University